HyperKat Support and Tester Forum
Mars Challenger V1.0 => MCO Early Discussions => Topic started by: Marco2001 on November 25, 2010, 08:47:39 PM
-
I've coded some messages in those quotes. Can you decrypt them?
1)
2)
(http://img10.imageshack.us/img10/4479/copyrf.png)
3)
- .... .. ... / --- -. . / .-- .- ... / . .- ... -.-- / -.. --- -. .----. - / -.-- --- ..- / - .... .. -. -.- ..--..
4)
(http://img403.imageshack.us/img403/6144/imagetxe.jpg)
5)
ATGGCTCGTTCTATTTCTAATATTTGTGAA
6)
(http://img408.imageshack.us/img408/4694/image2d0.jpg)
7)
#F5F5DC
#E6E6FA
#CD5C5C
#FFDEAD
#00008B
#FF00FF
#F0F8FF
#FFDEAD
8 )
(http://img228.imageshack.us/img228/7120/image3hy.jpg)
9) 42 (95.94) | 8 (15.999) | 7 (14.007)
10) VGhpcyB3YXMgdGhlIGxhc3Qgb25lIHRvZGF5LiANCkkgaG9wZSB5b3UgZW5qb3llZCBpdC4NCg0KLU1hcmNv
-
LOL, well some of them I could if I bothered =p
But the DNA one has me stumped. Same with whatever you used on the last one =p
-
2. Barcode was very easy for my S60 based cell phone with UpCode installed:D
1. I have absolutely no idea what that code is;]
3. Looks familiar to me, Morse?
4. Probably LSb in each pixel's RGB is data medium. I didn't check it, just assumption.
5. I am not sure how to interpret this in other then biochemical way:D
6. I can recognize some of this signs, but together... it has no sense:D
7. Is it so simple?:D
8. I don't know finger language;]
9. See 1.
10. Looks like this very old 'code' used on newsgroups for transferring binaries.
-
So no one knows what the messages are? :-X
Give it a try :D
-
well I know sighn language but I only recognise the letters first one I never saw but if I may I might confuse it with X, Second leter almost could be an M but I have never seen it like that, 3rd letter is an L and so is the 4th,5th letter is an F and 6th is a W. 7 is an F and 8 is an R , 9th 9 is an L again and the last could be a Z but I never seen a Z like that. Close but not quite the American Sign language I was taught. The rest I have no clue and I am not sure I want to task my brain with it. :)
-
Mars is the 4th planet from the sun.
This one was easy don't you think?
BLIND MAN
MoON
thats the easy ones any one else?
-
1. good job decrypting this
3. This one was easy don't you think?
5. Mars is nice