Author Topic: Coding game  (Read 3481 times)

0 Members and 1 Guest are viewing this topic.

Marco2001

  • Mission Commander
  • *****
  • Posts: 353
Coding game
« on: November 25, 2010, 08:47:39 PM »
I've coded some messages in those quotes. Can you decrypt them?

1)
Quote


2)
Quote

3)
Quote
- .... .. ... / --- -. . / .-- .- ... / . .- ... -.-- / -.. --- -. .----. - / -.-- --- ..- / - .... .. -. -.- ..--..

4)
Quote

5)
Quote
ATGGCTCGTTCTATTTCTAATATTTGTGAA

6)
Quote

7)
Quote
#F5F5DC
#E6E6FA
#CD5C5C
#FFDEAD
#00008B
#FF00FF
#F0F8FF
#FFDEAD

8 )
Quote

9)
Quote
42 (95.94) | 8 (15.999) | 7 (14.007)

10)
Quote
VGhpcyB3YXMgdGhlIGxhc3Qgb25lIHRvZGF5LiANCkkgaG9wZSB5b3UgZW5qb3llZCBpdC4NCg0KLU1hcmNv

Poland here. My time: GMT + 1h
Writing a book about Mars. Any ideas? Type to me.
I'am an Astrobiology/Biology student.

profit004

  • MCCS Test
  • Mission Commander
  • ******
  • Posts: 418
Re: Coding game
« Reply #1 on: November 26, 2010, 03:17:31 AM »
LOL, well some of them I could if I bothered =p

But the DNA one has me stumped.  Same with whatever you used on the last one =p

Mecanico

  • Specialist
  • ***
  • Posts: 44
Re: Coding game
« Reply #2 on: November 27, 2010, 12:43:18 PM »
2. Barcode was very easy for my S60 based cell phone with UpCode installed:D

1. I have absolutely no idea what that code is;]
3. Looks familiar to me, Morse?
4. Probably LSb in each pixel's RGB is data medium. I didn't check it, just assumption.
5. I am not sure how to interpret this in other then biochemical way:D
6. I can recognize some of this signs, but together... it has no sense:D
7. Is it so simple?:D
8. I don't know finger language;]
9. See 1.
10. Looks like this very old 'code' used on newsgroups for transferring binaries.
RESISTANCE IS FUTILE
Earth TZ: UT+1 (CEST)

Marco2001

  • Mission Commander
  • *****
  • Posts: 353
Re: Coding game
« Reply #3 on: November 28, 2010, 12:39:11 PM »
So no one knows what the messages are? :-X
Give it a try :D

Poland here. My time: GMT + 1h
Writing a book about Mars. Any ideas? Type to me.
I'am an Astrobiology/Biology student.

pad69

  • Mission Commander
  • *****
  • Posts: 142
  • The Robe Rules
Re: Coding game
« Reply #4 on: December 02, 2010, 11:53:10 PM »
well I know sighn language but I only recognise the letters first one I never saw but if I may I might confuse it with X, Second leter almost could be an M but I have never seen it like that, 3rd letter is an L and so is the 4th,5th letter is an F and 6th is a W. 7 is an F and 8 is an R , 9th 9 is an L again and the last could be a Z but I never seen a Z like that. Close but not quite the American Sign language I was taught. The rest I have no clue and I am not sure I want to task my brain with it. :)
Murphy's Law applies "Anything that can possibly go wrong, does." or some say it this way "If anything can go wrong, it will.

Phyco

  • Specialist
  • ***
  • Posts: 19
Re: Coding game
« Reply #5 on: December 03, 2010, 12:18:12 AM »
Mars is the 4th planet from the sun.

This one was easy don't you think?

BLIND MAN

MoON

thats the easy ones any one else?
« Last Edit: December 03, 2010, 02:17:50 AM by Phyco »
Everyone has Limits! NOT Everyone excepts them!

Master_Kethnic

  • Private
  • **
  • Posts: 5
Re: Coding game
« Reply #6 on: November 11, 2011, 04:31:30 PM »
1. good job decrypting this
3. This one was easy don't you think?
5. Mars is nice